BDBM50157832 3-Hydroxy-4a,7a-dihydro-1H-thieno[2,3-d]pyrimidine-2,4-dione::CHEMBL361350
SMILES O=c1[nH]c2sccc2c(=O)n1O
InChI Key InChIKey=NNWNTVVLCCOLEQ-UHFFFAOYSA-N
Data 8 IC50
Activity Spreadsheet -- Enzyme Inhibition Constant Data from BindingDB
Found 8 hits for monomerid = 50157832
Affinity DataIC50: 0.0250nMAssay Description:Inhibitory concentration against the Flap endonuclease-1More data for this Ligand-Target Pair
Affinity DataIC50: 0.101nMAssay Description:Inhibitory concentration against the xeroderma pigmentosum GMore data for this Ligand-Target Pair
Affinity DataIC50: 9nMAssay Description:Inhibition of FEN1 (unknown origin)More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 200nMAssay Description:Inhibition of RNH activity of recombinant HIV1 reverse transcriptase RNase H assessed as reduction in internal cleavage of RNA strand using RNA/DNA d...More data for this Ligand-Target Pair
Affinity DataIC50: 400nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
Affinity DataIC50: 1.00E+4nMAssay Description:Inhibition of polymerase activity of recombinant HIV1 reverse polymerase assessed as reduction in extension of an 18 nucleotide DNA primer using temp...More data for this Ligand-Target Pair
Affinity DataIC50: 3.50E+4nMAssay Description:Inhibition of HIV1 integrase pre-incubated for 10 mins before DNA substrate addition and measured after 30 minsMore data for this Ligand-Target Pair
Affinity DataIC50: 1.00E+5nMAssay Description:Inhibition of DNAse1 (unknown origin)More data for this Ligand-Target Pair
